Generation of a Transgenic Mouse Model of Middle East Respiratory Syndrome Coronavirus Infection and Disease

Construction and characterization of a hCD26 expressing plasmid in vitro.

The transgene cassette expressing hCD26 (also known as dipeptidyl peptidase-4 [DPP4]) was constructed using pCAGGS.MCS, a eukaryotic expression vector, as we previously described in making a construct expressing the hACE-2 receptor of SARS-CoV (15). Briefly, cDNA of hCD26, the viral receptor of MERS-CoV, which was generated from the mRNA of human phytohemagglutinin-activated T cells (16) and provided to us by C. Morimoto, University of Tokyo, Tokyo, Japan, was cloned into pCAGGS.MCS under the control of the CAG promoter, which is a composite promoter consisting of the cytomegalovirus (CMV)/immediate-early enhancer and the chicken β-actin promoter, containing rabbit globulin splicing and polyadenylation sites. This CAG promoter was chosen because it is a strong synthetic promoter frequently used to derive high levels of gene expression in mammalian expression vectors. In addition, it has an advantage over the first-generation CMV promoter in that its activity does not decline over generations of transgenic mouse breeding, as do some other CMV-based promoters (17). To verify the transgene construct, designated pCAGGS-hCD26 (Fig. 1A), we transfected 17CL-1 mouse fibroblast cells and assessed the expression of hCD26 protein by Western blotting analyses using a goat polyclonal antibody against hCD26 known to have ∼5% cross-reactivity to mouse CD26 (R&D Systems). Established hCD26-expressing mouse 17CL-1 cells, along with cells transfected with empty vector, were tested for MERS-CoV susceptibility to verify the permissiveness of hCD26-expressing cells to infection by monitoring yields of progeny virus and the formation of cytopathic effect (CPE).

Generation, detection, and breeding of transgenic mice.

The transgene (∼5.6 kb) comprising CAGG enhancer/promoter, intron sequence, human CD26 cDNA, and rabbit beta globin poly(A) signal was released from pCAGGS.hCD26 using SalI and AvrII restriction enzymes and injected into B6C3F1/J × C57BL/6J or C57BL/6J zygotes. G₀ founder mice were tested for transgene integration using quantitative PCR (qPCR) and/or Southern blot analysis. Briefly, tail genomic DNA isolated from tail biopsy specimens was subjected to qPCR using hCD26-specific primers (forward, 5′-CCAAAGACTGTACGGGTTCC-3′; reverse, 5′-TCAACATAGAAGCAGGAGCAG-3′) and fluorescence probe (5′-/56-FAM/AAGGCAGGAGCTGTGAATCCAACT/36-TAMSp/-3′) on a C1000 Touch thermocycler linked to a CFX96 real-time detection system (Bio-Rad). In some cases, Southern blot analysis was used to identify transgene-positive founder mice; for this, tail DNA was digested by BamHI, separated on agarose gels, and transferred to Hybond-XL (GE Healthcare Life Sciences). The blots were hybridized with ³²P-labeled probes prepared by random primed labeling. A 0.4-kb SalI-NcoI fragment of the CMV enhancer and a 0.7-kb BglII fragment (DPP4 3′ untranslated region [3′UTR]), isolated from pCAGGS.hCD26, were used as probes. The Gsc2 5′ probe was used to normalize the amount of DNA on the blots (18). The transgenic mouse experiments were carried out in the barrier facility of the University of Texas Medical Branch transgenic mouse core facility. All animal work conformed to National Institutes of Health (NIH) and AAALAC regulations and guidelines.

Virus and cells.

The EMC-2012 strain of MERS-CoV, kindly provided by Heinz Feldmann (NIH, Hamilton, MT) and Ron A. Fouchier (Erasmus Medical Center, Rotterdam, Netherlands), was used throughout the present study. Vero E6 cells (American Type Culture Collection) were used to expand the virus stocks and titrate the yields of progeny viruses. Briefly, confluent Vero E6 cells were inoculated with MERS-CoV/EMC-2012 (passage 2) at a multiplicity of infection (MOI) of 0.001 to generate the passage 3 working stock of the virus. The cell-free supernatants derived from infected cultures were titrated using Vero E6 cell-based infectivity assays and expressed as 50% tissue culture infectious dose (TCID₅₀)/ml. Aliquots of virus stock with a typical titer of ∼10⁷ TCID₅₀/ml were stored at −80°C. In addition, a strain of recombinant MERS-CoV expressing red fluorescent protein (rMERS-CoV/RFP), kindly provided by Ralph Baric, University of North Carolina at Chapel Hill (11), was similarly expanded and used in the indicated experiments to visualize the infection. All experiments involving infectious virus were conducted at the University of Texas Medical Branch (Galveston, TX) in approved biosafety level 3 (BSL-3) laboratories and animal facilities, with routine medical monitoring of staff.

Viral challenge and morbidity and mortality studies of infected mice.

All animal experiments were carried out in accordance with animal protocols approved by the Institutional Animal Care and Use Committee at the University of Texas Medical Branch. Since the result of a pilot study indicated that hCD26 transgene-positive (Tg⁺) mice of different genetic background were equally susceptible to MERS-CoV infection (data not shown), Tg⁺ and their age-matched transgene-negative (Tg⁻) littermates derived from the line 52 (see description below) founder mouse were backcrossed one or two times onto either a C57BL/6 or B6C3F1/J background. Anesthetized Tg⁺ and Tg⁻ littermates at ages 5 to 7 weeks were inoculated via the intranasal (i.n.) route with 10⁶ TCID₅₀ of MERS-CoV in a total volume of 80 μl. Animals were weighed and monitored daily for clinical signs of disease and abnormalities, including appearance, stereotypical behavior/abnormal movements, decreased responsiveness or activity, and weight loss. The clinical scoring system used was as follows: 0, no apparent illness; 1, mildly sick; 2, ruffled fur or hunching; 3, ruffled fur and hunching, with or without additional signs; 4, moribund; and 5, found dead. Some infected mice were sacrificed at indicated times postinfection (p.i.) to obtain tissue specimens for assessing the distribution of virus and associated histopathology using standard protocols, such as a Vero E6 cell-based infectivity assay, quantitative reverse transcription-PCR (qRT-PCR) assay, and immunohistochemical (IHC) staining.

Virus isolation.

Pieces of collected tissue specimens (lungs, brain, heart, liver, kidney, spleen, and intestine) were weighed and homogenized in phosphate-buffered saline (PBS)–10% fetal calf serum solution using a TissueLyser (Qiagen, Retsch, Haan, Germany) to yield 10% tissue–PBS suspensions. These suspensions were clarified by centrifugation and tested in a Vero E6 cell-based assay for titrating quantity of infectious virus. The virus titers of individual samples were expressed as TCID₅₀ per g of tissue.

RNA extraction and real-time quantitative qRT-PCR.

Pieces of tissues were transferred to individual vials containing RNAlater solution (Qiagen) and subsequently homogenized as described previously and subjected to total RNA isolation, using TRIzol Reagent (Life Technologies), for assessing MERS-CoV-specific genome targeting the virus-specific upstream E gene (upE) and mouse GAPDH gene (mGAPDH), as previously described (19). For the detection of hCD26 and viral gene expression in different tissues, 0.5 μg of RNA was used in a one-step real-time RT-PCR with a gene-specific primer/probe mix for the hCD26 gene and upE gene of MERS-CoV, using the Superscript III One-step RT-PCR kit (Invitrogen) according to the manufacturer's instructions. The primers and probes used for upE gene of MERS-CoV were as follows: forward, 5′-GCC TCT ACA CGG GAC CCA TA-3′; reverse, 5′-GCA ACG CGC GAT TCA GTT-3′; and fluorescence probe, 5′-/56-FAM/CTC TTC ACA TAA TCG CCC CGA GCT CG/36-TAMSp/-3′. The relative amount of targeted mRNA was obtained by normalizing with endogenous control gene (mGAPDH) and calculated in terms of the fold difference by the standard threshold cycle (ΔΔC_T) method (20).

Transcriptional profiling of cytokine and chemokine responses by qRT-PCR assays.

RNA extracted from either lung or brain tissue was subjected to qRT-PCR analyses for quantifying transcriptional expression of selected genes encoding key cytokines and chemokines. Briefly, 1 μg of RNA from an individual tissue obtained from infected Tg⁺ or Tg⁻ animals was converted to cDNA in a 20-μl reaction volume containing Superscript II (Invitrogen, Carlsbad, CA), oligo(dT) (500 ng), 20 U of RNase OUT, and 10 mM deoxynucleoside triphosphate mix in a 20-μl reaction volume. The reaction conditions were strictly according to the manufacturer's instructions. Transcription profiles of each cytokine/chemokine in the brain and lung were determined by real-time qPCR using iQ SYBR green PCR Supermix (Bio-Rad). Real-time reactions were set up in duplicate for each cytokine or chemokine using endogenous mouse GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene as internal controls for both brain and lung tissues using specific primer sets in Table 1. An identical amplification reaction condition consisting of (i) polymerase activation and DNA denaturation at 95°C for 3 min, (ii) 40 cycles each of the denaturation step at 95°C for 10 s, and (iii) an annealing/extension step at 60°C for 30 s was used for each gene analyzed. The reaction volume was kept at 10 μl by including 1 μl (10 ng) of cDNA from these reactions. The relative abundance of transcripts of each gene was calculated according to the comparative ΔΔC_T method (20).

Histology and IHC testing.

Tissues obtained from necropsy samples were fixed in 10% buffered formalin for 72 h, transferred to 70% ethanol, and later paraffin embedded. Histopathologic evaluation was performed on deparaffinized sections stained by routine hematoxylin-eosin (H&E) staining. IHC testing for MERS-CoV was performed using a previously described colorimetric indirect immunoalkaline phosphatase method (15) with a rabbit anti-MERS-CoV polyclonal antibody, a gift from Heinz Feldmann. The goat anti-hCD26 antibody (R&D Systems, catalog no. AF1180) was used to assess the distribution of hCD26 expression in transgenic mice by IHC analysis. Normal mouse and goat sera were used as negative antibody controls. Primary antibodies were detected with either biotinylated swine anti-rabbit immunoglobulin (Dako, catalog no. E0353) or rabbit anti-goat immunoglobulin (KPL, catalog no. 16-13-06) as secondary antibodies. Visualization was then achieved by incubation with streptavidin-alkaline phosphatase and naphthol-fast red substrate (Dako) and with counterstaining with Mayer's hematoxylin (Fisher Scientific).

Characterization of the hCD26 transgene construct in tissue culture.

To validate the potential of the hCD26 transgene cassette (Fig. 1A) in expressing the transgene, mouse fibroblastic 17 CL-1 cells were cotransfected with the hCD26 expression plasmid, pCAGGS-CD26, and a plasmid encoding puromycin resistance. After selection with puromycin (2 μg/ml), the transfectants were assessed for level of transgene expression at the protein level by both immunofluorescence (IF) staining and Western blotting analyses. As shown in Fig. 1B and C, an intense green fluorescence staining and a distinct band of ∼110 kDa in Western blots, the estimated size of hCD26, were seen almost exclusively in 17CL-1 cells transfected with the hCD26 expressing plasmid, indicating the effectiveness of the transgene construct in promoting cellular hCD26 expression. The much weaker band seen in wild-type 17CL-1 cells likely represented mouse CD26 as the anti-hCD26 antibody (R&D Systems) used for Western blotting was shown to having ∼5% cross-reactivity to mouse CD26. To determine whether the expression of hCD26 viral receptor would convert nonpermissive 17CL-1 cells to cells that support MERS-CoV infection, confluent cultures of 17CL-1/hCD26 cells and parental 17CL-1 cells were infected with either MERS-CoV or a recombinant MERS-CoV expressing red fluorescent protein (RFP) at an MOI of 1, followed by monitoring for morphological changes of infected cells and for the intensity of infection over time. In contrast to the infection-resistant parental 17CL-1 cells, 17CL-1/hCD26 cells were fully susceptible to MERS-CoV infection, resulting in the development of CPE (Fig. 1D), readily detectable expression of RFP (Fig. 1E), and high yields of infectious progeny virus as early as 1 day postinfection (dpi) (Fig. 1F). Based on these results, we conclude that induction of hCD26 expression using this transgene construct effectively converts nonpermissive 17CL-1 cells into permissive cells, capable of fully support MERS-CoV infection.

Generation and characterization of hCD26 transgenic mice.

Transgenic mice expressing hCD26 were generated by microinjecting the expression cassette, excised from pCAGGS-CD26 by AvrII/SalI digestion, into pronuclei of zygotes from either the C57BL/6J or C57BL/6J × B6C3F1/J background, as described in Materials and Methods, which led to 81 live births. Based on the qPCR and/or Southern blot analyses of tail DNA, we identified five B6/C3H hybrid and two B6 founders that were then crossed with C57BL/6J and/or B6C3F1/J to propagate the lines. Among seven Tg⁺ founder lineages, lines 52, 62, and 72 were selected, based on their ability to transmit hCD26 transgene to offspring, to further characterize hCD26 expression and expand the transgenic colonies. Southern blot analyses revealed that the intensity of hCD26 transgene was greatest in line 62, followed by line 72 and line 52, in that order (Fig. 2A). Line 62 suffered from both extremely poor transgene transmissibility and neonatal deaths of Tg⁺ pups, whereas the majority of Tg⁺ pups of Line 72 died prematurely at ∼3 weeks of age (Table 2). To evaluate the expression of hCD26 in lines 72 and 52, total RNA was extracted from tissues of Tg⁺ G₁ pups and subjected to qRT-PCR analysis using the same hCD26-specific primer-probe set used for tail genotyping. Although both lines expressed hCD26 in all tissues analyzed, the levels of hCD26 expression appeared to be higher in line 72 than in line 52, with the heart and spleen as the only exceptions (Fig. 2B).

In contrast to the extreme difficulty that we encountered to propagate lines 62 and 72, the line 52 founder mouse was capable of generating many first-, second-, and third-generation Tg⁺ pups that survived to maturity, permitting characterizing of hCD26 expression. To investigate the tissue distribution of hCD26 protein expression, cellular lysates and paraffin-embedded sections of various tissues were analyzed by Western blotting and IHC staining using a polyclonal antibody known to recognize hCD26 with <5% cross-reactivity to mouse CD26 (R&D Systems, catalog no. AF1180). Among six tissues analyzed (i.e., heart, lung, spleen, intestine, liver, and kidneys) by Western blotting, the expression of hCD26 was higher in both lungs and kidneys than in other tissues (Fig. 2C). The standard IHC assays also detected the expression of hCD26 antigen in all tissues analyzed, including the lung, brain, heart, liver, kidney, and intestine (Fig. 2D). We noted in Tg⁺ mice that hCD26 was primarily detected in both types of alveolar pneumocytes in lung and neuronal cells and endothelial cells in brain (Fig. 2Da and b). Prominent epithelial and/or endothelial hCD26 expression was detected in the liver, kidneys, and the gastrointestinal (GI) tract (Fig. 2Dd to f). Hepatic expression of hCD26 extended to the surface of hepatocytes. The expression of hCD26 was focalized within the muscularis layer of the GI tract and cardiomyocytes of the heart. Importantly, this positive staining is specific to hCD26 since no staining could be detected in tissues from Tg⁻ mice. Taken together, these results indicate that line 52 is a stable transgenic lineage globally expressing the hCD26 receptor for MERS-CoV.

Transgenic mice expressing hCD26 are permissive to MERS-CoV infection that results in disease and mortality.

With the characterized hCD26 transgenic lineage, we explored whether line 52 hCD26 Tg⁺ mice would be permissive to MERS-CoV infection. For a pilot study, we infected i.n. two Tg⁺ mice of different genetic backgrounds obtained from backcrossing to either B6 or B6C3F1/J mice, along with two Tg⁻ age-matched littermates, with 10⁶ TCID₅₀ of MERS-CoV in 80 μl. Mice were sacrificed 2 days later after infection to assess the yield of infectious virus in the lungs using Vero E6 cell-based infectivity assays. We found that Tg⁺ mice of different genetic background, but not those of Tg⁻ littermates, were equally susceptible to infection, as evidenced by high yields of infectious virus (data not shown).

Encouraged by the results of this pilot study, we subsequently inoculated additional age-matched line 52 Tg⁺ and Tg⁻ mice; nine animals in each Tg group were given 10⁶ TCID₅₀ i.n. in 80 μl for initial assessment of the kinetics of infection and disease. The tissue distribution of infection and disease was assessed by sacrificing two mice in each group at 2 and 6 dpi. Mice were monitored daily for signs of clinical illness, weight loss, and mortality. We noted that challenged Tg⁺, but not Tg⁻, mice developed an acute wasting syndrome, as evidenced by progressive weight loss starting at 2 dpi, reaching 30% at 5 dpi, and leading subsequently to 40 and 100% mortality at 5 and 6 dpi, respectively (Fig. 3A and B). Other clinical manifestations of infected Tg⁺ mice included ruffled fur, lethargy, inactivity, and rapid and shallow breathing. Despite their immobility, we did not observe any signs of neurological disorder, such as seizure or paralysis, in the Tg⁺ mice that were severely affected by MERS-CoV infection. The hCD26 Tg⁻ mice continued to thrive throughout the course of infection without showing any weight loss or signs of clinical illness.

Line 52 transgenic mice expressing hCD26 developed disseminated infection.

To determine the kinetics and tissue distribution, tissue specimens of Tg⁺ and Tg⁻ mice collected on 2 and 4 dpi were tested for infectious virus in the Vero E6 cell-based infectivity assay. It was clear that lung and brain appeared to be the prime sites of intense viral infection (Fig. 3C and D). We detected titers as high as ∼10⁷ TICD₅₀/g of lung at 2 dpi that dropped at 4 dpi to ∼10⁴ TCID₅₀/g, a net loss of 3 logs. In contrast to the acute and robust pulmonary infection, we were unable to isolate infectious virus from the brain until 4 dpi when an average of 7 × 10⁴ TCID₅₀/g was detected. These results indicate that the kinetics of MERS-CoV infection in the lung and brain of Tg⁺ mice were substantially different. Despite the high yields of infectious virus detected in the lung and brain, we were unable to isolate any infectious virus from other tissues, including the liver, heart, spleen, kidneys, and intestines, at either 2 or 4 dpi (data not shown). To verify the presence or absence of virus in tissues with no infectious virus, we tested for virus in all tissues collected at both 2 and 4 dpi for the presence of viral RNA by qRT-PCR targeting the upstream E gene of MERS-CoV. Consistent with the high yields of infectious virus, a 6-log-greater level of specific viral RNA was detected in the lungs and brains of infected Tg⁺ mice than in Tg⁻ mice (Fig. 3D). Importantly, MERS-CoV-specific viral RNA was also readily detected at either 2 or 4 dpi in the heart, spleen, and intestine, although we were not able to isolate any infectious virus, suggesting that a disseminated MERS-CoV infection had occurred in the hCD26 Tg⁺ mice. Interestingly, however, we were unable to detect any viral RNA in the liver and kidneys, despite the expression of hCD26 in these organs (Fig. 2B, C, and Dd and e).

Because high titers of infectious virus could be readily recovered from lungs and brains of challenged Tg⁺ mice, we performed IHC staining with paraffin-embedded tissues and a specific antibody for detecting viral antigen, as described in Materials and Methods, to confirm the cellular tropism of MERS-CoV infection for each tissue. As shown in Fig. 3E and G, lung alveolar pneumocytes, both type I and type II, and brain microglia, astrocytes, and neuronal cells expressed abundant viral antigen in Tg⁺ mice at 2 and 4 dpi, a finding consistent with the high titers of virus. These patterns of viral antigen expression were compatible with the cellular distribution of the hCD26 receptor for MERS-CoV (Fig. 2D), even though a two-color IHC staining was not performed. These findings indicate that transgenic mice expressing hCD26/DPP4 are highly susceptible to a MERS-CoV infection that results in significant morbidity and mortality.

Histopathology in MERS-CoV-infected hCD26 Tg⁺ mice.

Pathological changes in virally challenged Tg⁺ and Tg⁻ mice were assessed at 2 and 4 dpi. Consistent with the intense viral infection, gross lesions, consisting of discoloration (red to dark red) and multifocal consolidation, were observed in the lungs of Tg⁺ but not in Tg⁻ mice at 2 dpi, and changes had progressed at 4 dpi (Fig. 4A). Histological examination of the lung at 2 dpi showed a moderate bronchointerstitial pneumonitis and multifocal perivascular infiltrates with some changes extending into terminal bronchioles and adjacent pulmonary parenchyma. At 4 dpi, more intense cellular infiltrates, including pulmonary macrophages and lymphocytes, were seen within alveolar spaces (Fig. 4B). Both type I and type II alveolar epithelial cells appeared to be targets for MERS-CoV infection in hCD26 Tg⁺ mice (Fig. 2D). In contrast to the infected lungs, there was no necrosis or significant inflammatory reaction, other than mild perivascular cuffing identified in a single animal, observed in the brain, even at 4 dpi when the prominent viral infection was detected (Fig. 4C). Similarly, no pathological findings could be identified in other tissues collected from virus-challenged Tg⁺ or Tg⁻ mice (data not shown).

MERS-CoV infection induces inflammatory responses in the lung and brain of Tg⁺ mice.

As noted for SARS-CoV infection, significant cytokine and chemokine responses in the lungs of patients severely affected by MERS-CoV infection have been implicated as important mechanisms of MERS pathogenesis (13, 14, 21). The rapid onset of morbidity and mortality of hCD26 Tg⁺ mice in response to respiratory MERS-CoV challenge prompted us to explore the host cytokine/chemokine responses in the lung and brain, the two most affected tissues. Specifically, we determined the transcriptional activation of genes encoding classic antiviral cytokines (IFN-β, IFN-γ, and MX-1) and proinflammatory cytokines (IL-2, IL-6, IL-12p40, IL-1β, and TNF-α), as well as chemokines (G-CSF, MCP-1, IP-10, CXCL-1, MIP-1α, and RANTES), using qRT-PCR. These 14 genes were selected on the basis of their elevated expression in the lung and brain, as demonstrated by us in hACE2 transgenic mice in response to respiratory challenge with SARS-CoV (15, 22). As shown in Fig. 5, compared to the negligible gene activation of infected Tg⁻ mice, elevated mRNA levels of the majority of genes analyzed, including IL-1β, IL-6, TNF-α, G-CSF, MCP-1, IP-10, CXCL-1 (KC), MIP-1α, RANTES, and MX-1, were readily detected in both the lungs and brains of infected Tg⁺ mice in at least one time point evaluated (either 2 or 4 dpi) with few exceptions. Elevated mRNA expressions of both IFN-β and IFN-γ were observed exclusively within the lungs at 2 dpi, whereas activated IL-12p40-encoded gene could only be detected in the brain at 4 dpi. The IL-2-encoding gene was the only gene whose expression was not induced by MERS-CoV infection in Tg⁺ mice. We also noted that the magnitudes of gene activation in infected Tg⁺ mice were generally higher at 2 dpi in the lung and 4 dpi in brain, a pattern of response consistent with MERS-CoV replication within individual organs analyzed. Taken together, these results indicate not only that hCD26 Tg⁺ mice can fully support MERS-CoV infection, resulting in morbidity and mortality, but that they also respond to the infection by rapidly eliciting acute inflammatory responses.